The 24 DNA letters linked to autism: GCAAGGACATATGGGCGAAGGAGA
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders
A team of Spanish scientists has discovered the mechanism that could explain a high percentage of autism spectrum disorders

The State Meteorological Agency expects abundant, very strong and persistent rainfall from Tuesday, just two weeks after the worst DANA to have hit the country so far this century

The same storm system that caused deadly flash flooding in Spain’s Valencia region has now gripped parts of Catalonia

The outline of this labyrinthine cellular machinery, the most complex in humans, opens up new ways of designing treatments against a multitude of diseases
World in Progress Barcelona brings together politicians, intellectuals and entrepreneurs to reflect on the governance of a multipolar world at war

Grupo Prisa is organizing a conference in Barcelona to engage prominent politicians and intellectuals in a reflection on the future of geopolitics, industry, and climate change

Hundreds of ex-combatants from the losing side of the Civil War fought against the Nazis while enlisted in the British army. A new book reconstructs their story

The project, which is expected to be completed in 2027, seeks to rescue the Catalan capital’s most emblematic promenade from excessive tourism and gentrification. But it seems easier said than done

Researchers from the universities of Zurich, Yale and Harvard reveal the differences between the characteristics of the patients who receive the drug during pharmaceutical testing and those who end up receiving it, which may reduce its safety and efficacy

At its annual event in Perpignan, France, the ‘Visa pour l’Image’ festival pays tribute to the Pulitzer Prize-winning Spanish photojournalist with an exhibition that traces his career, marked by passion, risk and empathy

The Colombian singer claims in a letter published Wednesday that the Treasury manipulated her tax residency and was more interested in the media spectacle than in guaranteeing a fair process

More and more people are using this form of travel to get around the continent, using high-speed routes and a network of night trains that continues to expand. We traveled from Madrid to Prague and witnessed how the future of European transportation is clean and fast

The events begin on August 22 with a preliminary regatta, but the official competition starts on August 29. This year, Team New Zealand is the Defender

One of the greatest sailors in history is looking to finally bring the America’s Cup to the United Kingdom and complete a unique list of achievements

The sector expects almost 95 million international tourists will visit the country in 2024, around 10% more than the previous year

The massive global tourism industry doesn’t have factories that emit smoke. And yet, this sector can damage space, tranquility and entire communities

Alexis Roig, described by a former colleague as ‘a megalomaniac with a spectacular imagination,’ managed to sneak into a few outlets a bogus story about the inauguration in Kigali (Rwanda) of an institution that does not really exist

An association called SciTech DiploHub sent out a news release about a historic event that attracted 1,300 world leaders, including ministers, Nobel laureates and a Jordanian princess. The only problem is, it never took place

The young star of Spain’s national team, which will face England on Sunday at the Euro2024 final, has empowered the working-class community where he grew up by popularizing part of its zip code, 08304

The head of the event defends the management of the International Olympic Committee in past years, and speaks of a new approach to designating the host cities of the future

Rampant speculation and massive high-budget tourism have pushed housing prices to unsustainable limits. There is a shortage of civil servants, including law enforcement officers, while hospitals are transforming wings into residences to retain fleeing doctors and nurses

The World’s Best 50 Restaurants list of 2024 has rewarded a three-Michelin starred establishment whose three chefs and owners once trained at the legendary elBulli

The 12-year-old boy is the first person in Europe and the United States with congenital deafness that was able to hear thanks to gene therapy: he’s recovered his hearing, although he will probably never fully develop the ability to speak

Presented as an illustrated dictionary, a new book delves into the bizarre as the essence of Spanish national identity, in contrast to the epic narratives of patriotism adopted by the far right

It’s a crime whose rates are on the rise around the world, including in Spain, which registered 4,460 reports last year alone. Director Patricia Franquesa, who fell victim to the phenomenon, is turning her experience into a documentary

A center in Córdoba is leading a European study to determine the incidence of the disease, transmitted by rodents and the first diagnosis of which occurred in 2018 in Hong Kong

The digital project, the only center dedicated exclusively to the 1936-1939 conflict, has inaugurated new sections and encourages the public to share objects and personal experiences